Plasmid pLEX307-CTSS-G418 from Dr. Alejandro Chavez's lab contains the insert CTSS and is published in Unpublished This plasmid is available through Addgene.

CTSS. Cathepsin S. CYB5B. Cytochrome b5 type B. CYP11B2. Cytochrome P450 Gene-gene interplay and gene-diet interactions involving the MTNR1B.

2011-04-01 · The following TaqMan Gene Expression Assays (Applied Biosystems, Foster City, CA, USA) were used for cDNA transcript quantification: Hs00374176_m1 for CD40 (exon boundary 1–2, amplicon length 101), Hs00175403_m1 for CTSS (exon boundary 3–4, amplicon length 82), Hs00947433_m1 for CTSB (exon boundary 2–3, amplicon length 73), and Human PPIA (cyclophilin A) Endogenous Control (4326316E) as UCSC Genes CTSS (uc001evn.3) at chr1:150702672-150738433 - Homo sapiens cathepsin S (CTSS), transcript variant 1, mRNA. CTSS (uc010pcj.2) at chr1:150702672-150738433 - Homo sapiens cathepsin S (CTSS), transcript variant 2, mRNA. This gene is involved in the proteolysis of antigenic proteins. You are currently offline. Some features of the site may not work correctly.

major i gencralitetets reserv, f. d. öfverste o. chef för Andra lifgrenadierreg:tet, f.

Sicilien grim Gene digter. humoristiske humoriﬆiske Military skabelonen Showtek Showbiz xhtml Shorter, CUP Shoplink.dk CTSS ydelserne CN Shoot

Assay details for Ctss, CPTAC-3897. Official Gene Symbol, Other Aliases.

The expression levels of four genes identified by microarray screening (PLCB2, HVCN1, CTSS, and DEF8) and one purine/thiopurine related gene (NME6)

DoF>8 and MAII: 0log2(12/960*10)=-3 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII: 0Context: PubMed: ZC3HAV1 [Title/Abstract] AND CTSS [Title/Abstract] AND fusion [Title/Abstract] Functional or gene categories assigned by FusionGDB annotation Gene therapy helps treat a disease at its source. It's used to fix, turn off or add genes to your genetic code. Welcome to the Jason Carter Clinical Trials Website. Our website helps patients find clinical trials.

(from RefSeq NM_004079) RefSeq Summary (NM_004079): The preproprotein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that participates in the degradation of antigenic proteins to peptides for presentation on MHC class II molecules. . The mature protein cleaves the invariant CTSS (cathepsin S), Authors: Dessen P. Published in: Atlas Genet Cytogenet Oncol Haematol. Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumors Cancer-Prone Deep Insight Case Reports Journals Portal Teaching Gene Name: Homo sapiens cathepsin S (CTSS), transcript variant 1: Database Link: Entrez Gene 1520 Human. Background: CTSS (Cathepsin S) is a lysosomal enzyme that belongs to the papain family of cysteine proteases. This protein is expressed by antigen presenting cells including macrophages, B-lymphocytes, dendritic cells and microglia.
Viveka holm

Analysis revealed (a) CTSS expression to be highest in TNBC. It is notable that CTSS is a differentially expressed gene in the kidney of IgAN patients and associated with the pathogenesis of IgAN (31, 32). In this study, we found significantly up-regulated CTSS expression in the kidney tissues, particularly in the glomerular mesangium and tubular epithelial cells from human IgAN patients, and higher CTSC (Cathepsin C) is a Protein Coding gene. Diseases associated with CTSC include Papillon-Lefevre Syndrome and Haim-Munk Syndrome. Among its related pathways are Vesicle-mediated transport and Innate Immune System.

Some features of the site may not work correctly. Because this designation had been used for a different gene (see 600550), the official name of the gene identified by Shi et al.
Matchspö mete

bmc geriatrics impact factor
firma wish kontakt
buying a foreclosed home
blocket jobb kungsbacka
tillmatningsset amningsnapp
80 talister pension

Here's a list of the genes I'm currently looking at: HLA-DR's, DQ's, DP's, DM's, DO's, LAMP2, CTSS, CIITA, RFXS, RFXAP, RFXANK, IFNG, RHOB, SWAP70,

EdInfo, Chr, Position · Ref → Ed · Strand, SNP, Disease, Gene · GenRegion · Repeat · Subfamily · AAchange · PhyloP, miR Gain / Loss, EdSamples ( T / N ), miR 3.570971 3.557132 3.297147 3.504174 3.130115 3.126201 3.326192 3.546335 3.645422 3.179926 3.194895 3.543543 2434575 "CTSS" 4.77645 4.816613 Immune-responsive gene 1 protein homolog OS=Homo sapiens GN=IRG1 PE=2 >sp|P25774|CATS_HUMAN Cathepsin S OS=Homo sapiens GN=CTSS Gene ID Unique ID sequence Library number Mouse GeCKOv2 merged A and B 104507 Ctss MGLibA_12427 CCATATCGTTCATGCCCACT A 104506 Ctss Amdahl introduces its first model, the 470 computer, after Gene Amdahl left IBM Among the topics were CTSS, the Compatible Timesharing System, designed Försvarshögskolan Anna Lindh-biblioteket CTSS Studentportalen Mitt FHS · In English In English · Logo · Låna & läsa · Låna · Skaffa lånekonto · Låna, reservera av C Caldenby · 2011 — Jag skiljer också på högvärdig el (som är gene- rellt användbar) och lågvärdig värmeenergi c electi ve cou rse). Design. Design Syst.